Tomato sRNA S08637551
Sequence | Length | annotation |
AGUUGACGGCGUUAGAUUGAUACA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 312 | 130.47 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 75 | 76.69 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 440 | 110.75 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 1041 | 295.04 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 1013 | 259.17 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 73 | 35.16 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 27 | 22.43 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 195 | 110.57 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1583 | 488.43 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 2298 | 603.29 |
|