Tomato sRNA S08637554
| Sequence | Length | annotation |
| AGUUGACGGCGUUAGAUUGAUAUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3 | 0.65 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 9 | 0.66 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 801 | 617.26 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 677 | 513.58 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 775 | 552.14 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 990 | 729.11 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 1285 | 802.36 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 770 | 490.52 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 784 | 516.7 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 1109 | 677.98 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 901 | 539.35 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 274 | 267.34 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 475 | 277.29 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 199 | 195.21 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 465 | 328.86 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 632 | 688 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1250 | 1194.32 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 865 | 2498.75 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 888 | 618.62 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 1160 | 1547.94 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 296 | 123.78 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 96 | 98.16 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 322 | 81.05 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 433 | 122.72 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 383 | 97.99 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 115 | 55.4 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 72 | 59.81 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 162 | 91.85 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 526 | 162.29 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 898 | 235.75 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4 | 1.21 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 4 | 1.21 |
|