Tomato sRNA S08817826
| Sequence | Length | annotation |
|---|
| AUAAAGCUGUGGGAAGAUACA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 52 | 5.07 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 86 | 11.4 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 56 | 6.54 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 10 | 2.15 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 172 | 12.69 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 6 | 4.62 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 10 | 7.59 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 16 | 11.4 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 14 | 10.31 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 21 | 13.11 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 7 | 4.46 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 14 | 9.23 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 6 | 3.67 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 7 | 4.19 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 2 | 1.95 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 9 | 5.25 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 12 | 11.77 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 2 | 1.41 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 5 | 5.44 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1 | 0.96 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 3 | 2.09 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 11 | 14.68 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 12 | 3.07 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 4 | 1.93 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 11 | 3.39 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6 | 1.58 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 345 | 103.26 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 253 | 76.57 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 767 | 231.13 |
|
