Tomato sRNA S10235610
| Sequence | Length | annotation |
| AUCACGAUGUAGGCUCAGGCUA | 22 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 5 | 0.49 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 136 | 15.89 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 21 | 4.52 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 112 | 8.26 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 34 | 14.22 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 39 | 9.82 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 50 | 14.17 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 35 | 8.95 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 34 | 16.38 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 22 | 12.47 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 6 | 1.85 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 99 | 25.99 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 42 | 12.57 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 24 | 7.26 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 53 | 15.97 |
|