Tomato Functional Genomics Database (TFGD)

Tomato sRNA S10952602

Sequence	Length	annotation
AUGAUCAUUAGCGGCAUUUAAUU	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1	0.13
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	5	0.58
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	4	0.3
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	72	55.48
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	54	40.96
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	54	38.47
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	32	23.57
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	65	40.59
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	61	38.86
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	35	23.07
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	76	46.46
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	63	37.71
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	111	108.3
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	172	100.41
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	111	108.88
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	135	95.48
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	72	78.38
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	56	53.51
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	18	52
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	58	40.41
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	26	34.7
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	8	3.35
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	24	6.04
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	12	3.4
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	19	4.86
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	21	10.12
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	18	14.95
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	21	11.91
S0708	Solanum lycopersicum	MicroTom	flower, open	50	15.43
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	34	8.93
S0372	Solanum lycopersicum	Heinz 1706	flower	2	0.61