Tomato Functional Genomics Database (TFGD)

Tomato sRNA S11184179

Sequence	Length	annotation
AUGGCAGAGACAAUACCUGAAUA	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1	0.13
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	2	0.23
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1	0.22
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	11	0.81
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	18	13.87
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	39	29.59
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	6	4.27
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	23	16.94
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	25	15.61
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	27	17.2
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	23	15.16
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	36	22.01
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	20	11.97
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	487	475.17
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	479	279.63
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	667	654.28
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	223	157.71
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	170	185.06
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	246	235.04
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	116	335.09
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	4	2.79
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	14	18.68
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	15	6.27
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	31	7.8
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	9	2.55
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	31	7.93
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	10	4.82
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	6	4.98
S0708	Solanum lycopersicum	MicroTom	flower, open	22	6.79
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	32	8.4
S0373	Solanum lycopersicum	Heinz 1706	fruit	3	0.9
S0372	Solanum lycopersicum	Heinz 1706	flower	2	0.61
S0371	Solanum lycopersicum	Heinz 1706	leaf	1	0.3

S11184179 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc05g031610	1	23	+	click here