Tomato Functional Genomics Database (TFGD)

Tomato sRNA S11184180

Sequence	Length	annotation
AUGGCAGAGACAAUACCUGAAUAU	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	2	0.23
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	26	1.92
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	69	53.17
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	127	96.34
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	28	19.95
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	53	39.03
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	57	35.59
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	80	50.96
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	60	39.54
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	89	54.41
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	63	37.71
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	735	717.14
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	874	510.22
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	931	913.25
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	839	593.37
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	407	443.06
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	849	811.18
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	278	803.07
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	17	11.84
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	29	38.7
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	8	3.35
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	5	5.11
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	19	4.78
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	3	0.85
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	15	3.84
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	17	8.19
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	11	9.14
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	10	5.67
S0708	Solanum lycopersicum	MicroTom	flower, open	60	18.51
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	90	23.63
S0373	Solanum lycopersicum	Heinz 1706	fruit	3	0.9
S0372	Solanum lycopersicum	Heinz 1706	flower	10	3.03
S0371	Solanum lycopersicum	Heinz 1706	leaf	9	2.71

S11184180 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc05g031610	1	24	+	click here