Tomato sRNA S11184186
| Sequence | Length | annotation |
|---|
| AUGGCAGAGACAAUACCUGAGUA | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3 | 0.22 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 21 | 16.18 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 13 | 9.86 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 2 | 1.42 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 6 | 4.42 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 14 | 8.74 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 5 | 3.19 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 9 | 5.93 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 7 | 4.28 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 5 | 2.99 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 124 | 120.99 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 226 | 131.93 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 143 | 140.27 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 119 | 84.16 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 43 | 46.81 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 54 | 51.59 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 20 | 57.77 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 1 | 0.7 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 6 | 8.01 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 12 | 3.4 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 39 | 9.98 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 21 | 6.48 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 26 | 6.83 |
|
