Tomato sRNA S11184965
| Sequence | Length | annotation |
| AUGGCAGGAAGACAUGAGGCA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1 | 0.1 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3 | 0.65 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2 | 0.15 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 223 | 171.85 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 148 | 112.27 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 123 | 87.63 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 190 | 139.93 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 318 | 198.56 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 313 | 199.39 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 133 | 87.65 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 184 | 112.49 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 155 | 92.79 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 141 | 137.57 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 379 | 221.25 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 202 | 198.15 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 383 | 270.87 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 89 | 96.89 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 2 | 1.91 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 187 | 130.27 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 121 | 161.47 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 17 | 7.11 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 16 | 16.36 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 51 | 12.84 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 44 | 12.47 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 70 | 17.91 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 386 | 185.94 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 175 | 145.38 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 383 | 217.16 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 53 | 16.35 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 218 | 57.23 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3 | 0.9 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 13 | 3.93 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 3 | 0.9 |
S11184965 mapped to the follwoing genes
|