Tomato sRNA S11225251
| Sequence | Length | annotation |
| AUGGGUAGCACAAGGAUUAAU | 21 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 30 | 2.92 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 29 | 3.84 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 150 | 17.52 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 8 | 1.72 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 460 | 33.93 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 1 | 1.02 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2 | 0.5 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 7 | 1.79 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 11 | 5.3 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 8 | 6.65 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 35 | 19.85 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 3 | 0.93 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 5 | 1.31 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 132 | 39.51 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 141 | 42.67 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 174 | 52.43 |
|