Tomato sRNA S11284979
| Sequence | Length | annotation |
|---|
| AUGUAAGGAUAUGACACAUGAGCC | 24 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 7 | 0.68 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3 | 0.4 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 9 | 1.05 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 73 | 15.72 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3 | 0.22 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 1 | 0.77 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 3 | 1.87 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 4 | 2.55 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 3 | 1.98 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 1 | 0.98 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 4 | 2.34 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 2 | 2.18 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 1 | 1.33 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 1 | 0.26 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 3 | 0.93 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6 | 1.58 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 26 | 7.78 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 50 | 15.13 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 8 | 2.41 |
|
