Tomato sRNA S13318084
Sequence | Length | annotation |
CAUGGCAGAGACAAUACCUGAAUA | 24 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 21 | 1.55 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 19 | 14.64 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 36 | 27.31 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 23 | 16.39 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 40 | 29.46 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 48 | 29.97 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 17 | 10.83 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 33 | 21.75 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 42 | 25.68 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 32 | 19.16 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 76 | 74.15 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 57 | 33.28 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 114 | 111.83 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 78 | 55.16 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 35 | 38.1 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 83 | 79.3 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 36 | 103.99 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 10 | 6.97 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 12 | 16.01 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 10 | 2.52 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 7 | 1.98 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 15 | 3.84 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 11 | 9.14 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 7 | 3.97 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 36 | 11.11 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 31 | 8.14 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 3 | 0.9 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 5 | 1.51 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2 | 0.6 |
|