Tomato Functional Genomics Database (TFGD)

Tomato sRNA S13318185

Sequence	Length	annotation
CAUGGCAGGAAGACAUGAGGC	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	34	3.31
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	14	1.86
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	3	0.35
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1	0.22
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	135	104.03
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	52	39.45
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	54	38.47
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	103	75.86
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	106	66.19
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	106	67.53
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	56	36.91
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	59	36.07
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	81	48.49
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	62	60.49
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	172	100.41
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	134	131.45
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	126	89.11
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	29	31.57
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	1	2.89
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	76	52.94
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	105	140.12
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	7	2.93
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	3	3.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	16	4.03
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	3	0.85
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	16	4.09
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	82	39.5
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	85	70.61
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	51	28.92
S0708	Solanum lycopersicum	MicroTom	flower, open	16	4.94
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	64	16.8
S0372	Solanum lycopersicum	Heinz 1706	flower	3	0.91

S13318185 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc00g144470	1191	1211	+	click here
Solyc02g067130	996	1016	+	click here
Solyc06g035480	1065	1085	+	click here
Solyc08g066370	1344	1364	+	click here
Solyc09g061650	576	596	+	click here