Tomato sRNA S13318188

SequenceLengthannotation
CAUGGCAGGAAGACAUGAGGCAUU24miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0736Solanum lycopersicumAilsa Craigfruit, immature (17 days after anthesis)40.86
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 167128.69
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 6347.79
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 7352.01
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 10375.86
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 172107.4
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 13485.36
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 9763.93
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 15393.54
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 287171.8
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate34341.96
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate216998.66
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate14443.16
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate210473.55
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate11819.59
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate210975.93
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate194125.44
S0716Solanum lycopersicumMicroTom fruit , 7 days post breaker41.67
S0715Solanum lycopersicumMicroTom fruit , 5 days post breaker1111.25
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker133.27
S0713Solanum lycopersicumMicroTom fruit , breaker stage154.25
S0712Solanum lycopersicumMicroTom fruit , mature green338.44
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter12158.29
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter10284.74
S0709Solanum lycopersicumMicroTom fruit , 1mm to 3mm in diameter16492.99
S0708Solanum lycopersicumMicroTom flower, open3611.11
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming26369.04
S0372Solanum lycopersicumHeinz 1706flower30.91

S13318188 mapped to the follwoing genes

gene IDstart positionstop positionstrandexpression
Solyc00g14447011911214+click here
Solyc02g0671309961019+click here
Solyc06g03548010651088+click here
Solyc08g06637013441367+click here
Solyc09g061650576599+click here