Tomato sRNA S13524470
| Sequence | Length | annotation |
| CCAUCACGAUGUAGGCUCAGGC | 22 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 133 | 12.96 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 27 | 3.58 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 10 | 1.17 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 14 | 3.01 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 7 | 0.52 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 5 | 1.26 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 9 | 2.55 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 1 | 0.26 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 4 | 3.32 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 11 | 6.24 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 1 | 0.26 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 5 | 1.51 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 2 | 0.6 |
|