Tomato sRNA S14051923
| Sequence | Length | annotation |
| CGGAGAGUAGAAGGCAAGAG | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 4 | 0.3 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 224 | 93.67 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 112 | 114.53 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 644 | 162.1 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 162 | 45.91 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 202 | 51.68 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 178 | 85.74 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 95 | 78.92 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 312 | 176.9 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 62 | 19.13 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 113 | 29.67 |
|