Tomato sRNA S14429049
| Sequence | Length | annotation |
|---|
| CUAUGAGAUAAGUUCAACGUG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 3017 | 293.99 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1419 | 188.08 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1705 | 199.18 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 673 | 144.93 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 5137 | 378.9 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 5 | 2.09 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 14 | 3.52 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 4 | 1.13 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 11 | 2.81 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 14 | 7.94 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 28 | 8.64 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 41 | 10.76 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 417 | 124.81 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 177 | 53.57 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 419 | 126.26 |
|
