Tomato sRNA S14956632
| Sequence | Length | annotation |
|---|
| CUUGGACUGAAGGGAGCUCCC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 2 | 0.23 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 25 | 5.38 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 167 | 128.69 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 15 | 11.38 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 5 | 3.56 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 15 | 11.05 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 17 | 10.61 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 53 | 33.76 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 73 | 48.11 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 47 | 28.73 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 97 | 58.07 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 4 | 3.9 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 10 | 5.84 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 1 | 0.71 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 82 | 89.27 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 35 | 33.44 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 15 | 43.33 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 21 | 14.63 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 39 | 52.04 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 93 | 24.42 |
|
