Tomato sRNA S16766588
| Sequence | Length | annotation |
| GAUAGUACAGGUAGGAAACUCACA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 19 | 1.85 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 22 | 2.92 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 105 | 12.27 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 25 | 5.38 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 408 | 30.09 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 3 | 1.7 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 5 | 1.54 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 10 | 2.63 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 261 | 78.12 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 881 | 266.63 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 257 | 77.44 |
|