Tomato Functional Genomics Database (TFGD)

Tomato sRNA S17569846

Sequence	Length	annotation
GCUGACGGCAUUAGAUUGAUAUA	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	4	0.3
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	79	60.88
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	73	55.38
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	73	52.01
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	87	64.07
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	89	55.57
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	59	37.59
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	55	36.25
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	85	51.96
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	79	47.29
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	71	69.27
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	108	63.05
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	68	66.7
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	33	23.34
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	60	65.32
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	41	39.17
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	46	132.88
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	98	68.27
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	100	133.44
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	113	47.25
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	34	34.77
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	103	25.93
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	189	53.57
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	118	30.19
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	24	11.56
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	22	18.28
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	6	3.4
S0708	Solanum lycopersicum	MicroTom	flower, open	40	12.34
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	47	12.34
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3