Tomato Functional Genomics Database (TFGD)

Tomato sRNA S17569896

Sequence	Length	annotation
GCUGACGGCGUUAGAUUGAUAUA	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1	0.1
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1	0.22
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	11	0.81
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	97	74.75
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	46	34.9
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	40	28.5
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	54	39.77
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	85	53.07
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	44	28.03
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	44	29
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	51	31.18
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	48	28.73
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	305	297.59
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	325	189.73
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	394	386.49
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	340	240.46
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	153	166.56
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	352	336.32
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	124	358.2
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	111	77.33
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	91	121.43
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	32	13.38
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	11	11.25
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	19	4.78
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	64	18.14
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	33	8.44
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	11	5.3
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	3	2.49
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	12	6.8
S0708	Solanum lycopersicum	MicroTom	flower, open	10	3.09
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	30	7.88
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3