Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
GGAAUCUUGAUGAUGCUGCAG	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	58	5.65
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	234	31.02
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	14	1.64
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1	0.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	1	0.25
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	4	1.02
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	8	3.85
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	1	0.83
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	21	11.91
S0708	Solanum lycopersicum	MicroTom	flower, open	244	75.28
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	85	22.31
S0373	Solanum lycopersicum	Heinz 1706	fruit	18	5.39
S0372	Solanum lycopersicum	Heinz 1706	flower	544	164.64
S0371	Solanum lycopersicum	Heinz 1706	leaf	17	5.12