Tomato sRNA S17736640
| Sequence | Length | annotation |
| GGAAUGUUGUUUGGCUCGAAG | 21 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 35 | 3.41 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 28 | 3.71 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 59 | 6.89 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 4 | 0.86 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 14 | 1.03 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2 | 0.51 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1 | 0.57 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 1 | 0.26 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 12 | 3.59 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 30 | 9.08 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 51 | 15.37 |
|