Tomato sRNA S17811956
Sequence | Length | annotation |
GGAGAAGCAGGGCACGUGCA | 20 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 52 | 5.07 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 56 | 7.42 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 177 | 20.68 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2 | 0.15 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 435 | 181.9 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 70 | 71.58 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 716 | 180.22 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 51 | 14.45 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 53 | 13.56 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 10 | 4.82 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 7 | 2.16 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 119 | 31.24 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 7 | 2.1 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 |
|