Tomato sRNA S18019913

SequenceLengthannotation
GGCAGAGACAAUACCUGAAUAUG23miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739Solanum lycopersicumAilsa Craigfruit, red ripe (52 days after anthesis)20.19
S0738Solanum lycopersicumAilsa Craigfruit, breaker (42 days after anthesis)40.53
S0737Solanum lycopersicumAilsa Craigfruit, mature green (39 days after anthesis)30.35
S0735Solanum lycopersicumSunnyleaf , TSWV-infected80.59
S0734Solanum lycopersicumIL8-3-1seedlings, two-week-old 1713.1
S0733Solanum lycopersicumIL8-3seedlings, two-week-old 1712.9
S0732Solanum lycopersicumIL8-2-1seedlings, two-week-old 74.99
S0731Solanum lycopersicumIL8-2seedlings, two-week-old 75.16
S0730Solanum lycopersicumIL8-1-3seedlings, two-week-old 85
S0729Solanum lycopersicumIL8-1Dseedlings, two-week-old 1610.19
S0728Solanum lycopersicumIL8-1-1seedlings, two-week-old 127.91
S0727Solanum lycopersicumIL2-5seedlings, two-week-old 159.17
S0726Solanum lycopersicumIL1-1seedlings, two-week-old 116.58
S0725Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate39794.64
S0724Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate27242.03
S0723Solanum lycopersicum x S. pennelliiM82 x LA716 (F2)seedlings, two-week-old , replicate1142139.29
S0722Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate27955.87
S0721Solanum lycopersicum x S. pennelliiM82 x LA716 (F1)seedlings, two-week-old , replicate17682.73
S0720Solanum pennelliiLA716seedlings, two-week-old , replicate2115109.88
S0719Solanum pennelliiLA716seedlings, two-week-old , replicate12572.22
S0718Solanum lycopersicumM82seedlings, two-week-old , replicate2139.06
S0717Solanum lycopersicumM82seedlings, two-week-old , replicate145.34
S0716Solanum lycopersicumMicroTom fruit , 7 days post breaker135.44
S0714Solanum lycopersicumMicroTom fruit , 3 days post breaker112.77
S0713Solanum lycopersicumMicroTom fruit , breaker stage133.68
S0712Solanum lycopersicumMicroTom fruit , mature green287.16
S0711Solanum lycopersicumMicroTom fruit , 11mm to 14mm in diameter20.96
S0710Solanum lycopersicumMicroTom fruit , 5mm to 7mm in diameter32.49
S0708Solanum lycopersicumMicroTom flower, open92.78
S0707Solanum lycopersicumMicroTom flower bud, closed bud before flower blooming133.41
S0373Solanum lycopersicumHeinz 1706fruit20.6

S18019913 mapped to the follwoing genes

gene IDstart positionstop positionstrandexpression
Solyc05g031610325+click here