Tomato Functional Genomics Database (TFGD)

Tomato sRNA S18019913

Sequence	Length	annotation
GGCAGAGACAAUACCUGAAUAUG	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	2	0.19
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	4	0.53
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	3	0.35
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	8	0.59
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	17	13.1
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	17	12.9
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	7	4.99
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	7	5.16
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	8	5
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	16	10.19
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	12	7.91
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	15	9.17
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	11	6.58
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	97	94.64
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	72	42.03
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	142	139.29
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	79	55.87
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	76	82.73
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	115	109.88
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	25	72.22
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	13	9.06
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	4	5.34
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	13	5.44
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	11	2.77
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	13	3.68
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	28	7.16
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	2	0.96
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	3	2.49
S0708	Solanum lycopersicum	MicroTom	flower, open	9	2.78
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	13	3.41
S0373	Solanum lycopersicum	Heinz 1706	fruit	2	0.6

S18019913 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc05g031610	3	25	+	click here