Tomato Functional Genomics Database (TFGD)

Tomato sRNA S18230750

Sequence	Length	annotation
GGGAUGUUGUCUGGCUCGACA	21

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	373	36.35
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	153	20.28
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	485	56.66
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	78	16.8
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	28	2.07
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	1	0.42
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	2	0.5
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	3	0.77
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	7	3.37
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	2	1.66
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	10	5.67
S0708	Solanum lycopersicum	MicroTom	flower, open	3	0.93
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	16	4.2
S0373	Solanum lycopersicum	Heinz 1706	fruit	1	0.3
S0372	Solanum lycopersicum	Heinz 1706	flower	9	2.72
S0371	Solanum lycopersicum	Heinz 1706	leaf	1	0.3

S18230750 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc01g104150	35	55	+	click here