Tomato Functional Genomics Database (TFGD)

Tomato sRNA S18235633

Sequence	Length	annotation
GGGAUUGUAGGCAGAGAGAUGGC	23	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2	0.15
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	143	110.2
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	26	19.72
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	94	66.97
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	111	81.75
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	141	88.04
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	52	33.13
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	73	48.11
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	109	66.64
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	137	82.01
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	11	10.73
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	9	5.25
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	6	5.89
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	28	19.8
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	45	48.99
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	9	8.6
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	11	31.78
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	65	45.28
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	98	130.77
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	15	6.27
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	14	14.32
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	33	8.31
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	32	9.07
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	24	6.14
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	68	32.76
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	65	54
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	174	98.66
S0708	Solanum lycopersicum	MicroTom	flower, open	27	8.33
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	49	12.86
S0372	Solanum lycopersicum	Heinz 1706	flower	1	0.3