Tomato sRNA S18235633
Sequence | Length | annotation |
GGGAUUGUAGGCAGAGAGAUGGC | 23 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 2 | 0.15 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 143 | 110.2 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 26 | 19.72 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 94 | 66.97 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 111 | 81.75 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 141 | 88.04 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 52 | 33.13 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 73 | 48.11 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 109 | 66.64 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 137 | 82.01 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 11 | 10.73 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 9 | 5.25 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 28 | 19.8 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 45 | 48.99 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 9 | 8.6 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 11 | 31.78 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 65 | 45.28 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 98 | 130.77 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 15 | 6.27 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 14 | 14.32 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 33 | 8.31 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 32 | 9.07 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 24 | 6.14 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 68 | 32.76 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 65 | 54 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 174 | 98.66 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 27 | 8.33 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 49 | 12.86 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1 | 0.3 |
|