Tomato sRNA S19186048
| Sequence | Length | annotation |
|---|
| GUCCAAGAAAGCUGUGGGAAA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 19 | 1.85 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 24 | 3.18 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1491 | 174.18 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 29 | 6.24 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 27 | 1.99 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 3 | 0.77 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 28 | 13.49 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 11 | 9.14 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 6 | 3.4 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 3 | 0.93 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 11 | 2.89 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 6 | 1.8 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 13 | 3.93 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 3 | 0.9 |
|
