Tomato sRNA S19864876
| Sequence | Length | annotation |
|---|
| GUUCAAUAAAGCUGUGGGAA | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 55 | 5.36 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 28 | 3.71 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 252 | 29.44 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 111 | 23.9 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 29 | 2.14 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 3 | 2.31 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 2 | 1.52 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 3 | 2.14 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 3 | 2.21 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 13 | 8.12 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 3 | 1.91 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 5 | 3.3 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 3 | 1.83 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 3 | 1.8 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 8 | 7.81 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 3 | 1.75 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 2 | 1.96 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 6 | 4.24 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 17 | 18.51 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 10 | 9.55 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 2 | 5.78 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 9 | 6.27 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 3 | 4 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 10 | 2.52 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 5 | 1.28 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 248 | 119.46 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 94 | 78.09 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 9 | 2.36 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4 | 1.21 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|
