Tomato Functional Genomics Database (TFGD)

Tomato sRNA S19943157

Sequence	Length	annotation
GUUGACGGCGUUAGAUUGAUAUAC	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	11	0.81
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	27	20.81
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	14	10.62
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	22	15.67
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	41	30.2
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	57	35.59
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	27	17.2
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	20	13.18
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	39	23.84
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	31	18.56
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	22	21.47
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	39	22.77
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	8	7.85
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	33	23.34
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	47	51.16
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	68	64.97
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	42	121.33
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	77	53.64
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	37	49.37
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	2	0.84
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	5	5.11
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	9	2.27
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	14	3.97
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	22	5.63
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	5	2.41
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	3	2.49
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	2	1.13
S0708	Solanum lycopersicum	MicroTom	flower, open	12	3.7
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	39	10.24