Tomato sRNA S20441305
| Sequence | Length | annotation |
| UAACUUCGUCUAGCUCGCCUUC | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 99 | 9.65 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 45 | 5.96 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 94 | 10.98 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1296 | 279.08 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 443 | 32.68 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 3 | 1.25 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 2 | 2.05 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 14 | 3.52 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 3 | 0.85 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 10 | 2.56 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 2 | 0.96 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 3 | 2.49 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 12 | 6.8 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6 | 1.58 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 500 | 149.66 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 189 | 57.2 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 88 | 26.52 |
|