Tomato sRNA S20528511
| Sequence | Length | annotation |
|---|
| UAAGGAUAUGACACAUGAGC | 20 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 5 | 0.49 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 1 | 0.77 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 1 | 0.71 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 1 | 0.64 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 5 | 3.3 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 1 | 0.61 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 2 | 1.2 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 1 | 0.98 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 2 | 1.17 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 6 | 5.89 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 3 | 4 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 2 | 0.5 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 8 | 2.05 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 8 | 3.85 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 5 | 4.15 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 22 | 12.47 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 11 | 3.39 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 25 | 6.56 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|
