Tomato sRNA S21066129
Sequence | Length | annotation |
UAGAUGUGCAUACUCAAAGUU | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 5 | 0.49 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 10 | 1.33 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 39 | 4.56 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1236 | 91.17 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 254 | 195.74 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 415 | 314.82 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 350 | 249.35 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 236 | 173.81 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 283 | 176.71 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 275 | 175.19 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 243 | 160.15 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 266 | 162.62 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 190 | 113.74 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 287 | 280.03 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 436 | 254.52 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 236 | 231.5 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 330 | 233.39 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 175 | 190.51 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 8 | 7.64 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 6 | 17.33 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 204 | 142.11 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 182 | 242.87 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 44 | 18.4 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 6 | 6.14 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 50 | 12.59 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 7 | 1.98 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 39 | 9.98 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 17 | 9.64 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 157 | 48.44 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 125 | 32.82 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 329 | 98.47 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 377 | 114.1 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 521 | 157 |
|