Tomato sRNA S22423036
| Sequence | Length | annotation |
| UCGCUUGGUGCAGGUCGGGACC | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1503 | 146.46 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 454 | 60.18 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 110 | 12.85 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 7288 | 1569.42 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 4953 | 365.33 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1 | 0.42 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 4 | 1.01 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 11 | 3.12 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 2 | 0.51 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 7 | 3.37 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 4 | 2.27 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 5 | 1.31 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 30 | 8.98 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 34 | 10.29 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 88 | 26.52 |
S22423036 mapped to the follwoing genes
|