Tomato Functional Genomics Database (TFGD)

Tomato sRNA S22423036

Sequence	Length	annotation
UCGCUUGGUGCAGGUCGGGACC	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	1503	146.46
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	454	60.18
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	110	12.85
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	7288	1569.42
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	4953	365.33
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	1	0.42
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	3	3.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	4	1.01
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	11	3.12
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	2	0.51
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	7	3.37
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	7	5.82
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	4	2.27
S0708	Solanum lycopersicum	MicroTom	flower, open	4	1.23
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	5	1.31
S0373	Solanum lycopersicum	Heinz 1706	fruit	30	8.98
S0372	Solanum lycopersicum	Heinz 1706	flower	34	10.29
S0371	Solanum lycopersicum	Heinz 1706	leaf	88	26.52

S22423036 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc08g005690	117	138	-	click here