Tomato Functional Genomics Database (TFGD)

Tomato sRNA S22433644

Sequence	Length	annotation
UCGGACCAGGCUUCAUUCCC	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	8	0.78
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	8	1.06
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	252	29.44
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	853	183.69
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1840	135.72
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	140	107.89
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	84	63.72
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	48	34.2
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	57	41.98
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	119	74.3
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	114	72.62
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	100	65.91
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	119	72.75
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	86	51.48
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	124	120.99
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	245	143.02
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	180	176.57
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	252	178.22
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	40	43.54
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	63	60.19
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	61	176.21
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	40	27.87
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	62	82.73
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	44	18.4
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	13	13.29
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	280	70.48
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	53	15.02
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	368	94.15
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	963	463.88
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	283	235.1
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	308	174.64
S0708	Solanum lycopersicum	MicroTom	flower, open	63	19.44
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	136	35.7
S0373	Solanum lycopersicum	Heinz 1706	fruit	542	162.23
S0372	Solanum lycopersicum	Heinz 1706	flower	771	233.34
S0371	Solanum lycopersicum	Heinz 1706	leaf	713	214.86

S22433644 mapped to the follwoing genes

gene ID	start position	stop position	strand	expression
Solyc08g083150	113	132	+	click here