Tomato sRNA S22433645
Sequence | Length | annotation |
UCGGACCAGGCUUCAUUCCCC | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1487 | 144.9 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1133 | 150.17 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 6736 | 786.91 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 24621 | 5301.96 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 299402 | 22083.9 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 9751 | 7514.27 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 8157 | 6187.95 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 5443 | 3877.79 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 4035 | 2971.68 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 9071 | 5663.99 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 8544 | 5442.89 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 8474 | 5584.79 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 9195 | 5621.34 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 7914 | 4737.42 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 8412 | 8207.59 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 20286 | 11842.4 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 10455 | 10255.7 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 22248 | 15734.5 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 3342 | 3638.11 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 3208 | 3065.1 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 5662 | 16356 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 1501 | 1045.66 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 6822 | 9103.51 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 3607 | 1508.31 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 804 | 822.13 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 17364 | 4370.6 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 4239 | 1201.43 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 20765 | 5312.52 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 4989 | 2403.19 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1515 | 1258.57 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1261 | 714.99 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4163 | 1284.47 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 7152 | 1877.59 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 124829 | 37363.1 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 67954 | 20565.7 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 139323 | 41983.8 |
S22433645 mapped to the follwoing genes
|