Tomato sRNA S22433659
| Sequence | Length | annotation |
| UCGGACCAGGCUUCAUUCCUC | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 1076 | 104.85 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 781 | 103.52 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1099 | 128.39 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 3373 | 726.35 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 248892 | 18358.2 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 1078 | 450.78 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 167 | 170.77 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 3573 | 899.34 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 937 | 265.57 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 5151 | 1317.83 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1721 | 829 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 549 | 456.08 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 1279 | 725.2 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 5625 | 1735.56 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 10779 | 2829.78 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 5399 | 1616 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 107719 | 32600.3 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 33682 | 10149.8 |
|