Tomato sRNA S22826029
| Sequence | Length | annotation |
|---|
| UCUUGGAUUUUAUCGGAGUUAA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1820 | 134.24 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 1 | 0.48 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 2 | 0.62 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 24 | 7.18 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 88 | 26.63 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 17 | 5.12 |
|
