Tomato sRNA S22848263
| Sequence | Length | annotation |
|---|
| UCUUUCCUACUCCUCCCAUA | 20 | |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 3 | 0.4 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 5 | 0.58 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 2 | 0.43 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 11 | 0.81 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 6 | 4.62 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 12 | 9.1 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 8 | 5.7 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 4 | 2.95 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 6 | 3.75 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 10 | 6.37 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 4 | 2.64 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 6 | 3.67 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 2 | 1.2 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 14 | 13.66 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 29 | 16.93 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 22 | 21.58 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 24 | 16.97 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 5 | 5.44 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 11 | 10.51 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 5 | 14.44 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 6 | 4.18 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 5 | 6.67 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1 | 0.25 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 1 | 0.26 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 9 | 4.34 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 4 | 3.32 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 2 | 0.53 |
|
