Tomato sRNA S22951927
| Sequence | Length | annotation |
| UGAACCUGCAUCGUGAUGGCCU | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 8 | 0.78 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 6 | 0.8 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 7 | 0.82 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 1478 | 109.02 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 78 | 32.62 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 12 | 12.27 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 147 | 37 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 104 | 29.48 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 220 | 56.28 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 43 | 20.71 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 45 | 37.38 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 67 | 37.99 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 272 | 83.92 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 226 | 59.33 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 275 | 82.31 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 203 | 61.44 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 327 | 98.54 |
|