Tomato sRNA S22951928
| Sequence | Length | annotation |
| UGAACCUGCAUCGUGAUGGCCUG | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 23 | 2.24 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 7 | 0.93 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 23 | 2.69 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3586 | 264.5 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 88 | 36.8 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 58 | 59.31 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 88 | 22.15 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 247 | 70.01 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 216 | 55.26 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 20 | 9.63 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 17 | 14.12 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 33 | 18.71 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 90 | 27.77 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 184 | 48.3 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 832 | 249.03 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 460 | 139.22 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 768 | 231.43 |
|