Tomato sRNA S23003515
Sequence | Length | annotation |
UGAAGCUGCCAGCAUGAUCUA | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 76 | 7.41 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 25 | 3.31 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 741 | 86.57 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 333 | 71.71 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 80413 | 5931.25 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 3087 | 2378.89 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 2307 | 1750.1 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 2005 | 1428.44 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 1207 | 888.93 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 2235 | 1395.55 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 1311 | 835.16 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 1207 | 795.47 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 1297 | 792.92 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 1532 | 917.08 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 4266 | 4162.34 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 5921 | 3456.52 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 4631 | 4542.71 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 4535 | 3207.3 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 2863 | 3116.67 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 3957 | 3780.74 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1029 | 2972.5 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 2106 | 1467.13 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 1089 | 1453.2 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 20 | 8.36 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 9 | 9.2 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 101 | 25.42 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 7 | 1.98 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 323 | 82.64 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 133 | 64.07 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 34 | 28.25 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 166 | 94.12 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 2971 | 916.68 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 2518 | 661.04 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 85 | 25.44 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 8042 | 2433.84 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 4838 | 1457.89 |
|