Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UGAAUCCUUCGGCUAUCCAUA	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	130	12.67
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	68	9.01
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	298	34.81
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	129	27.78
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	5991	441.9
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	23	9.62
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	16	16.36
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	171	43.04
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	44	12.47
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	202	51.68
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	222	106.94
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	66	54.83
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	240	136.08
S0708	Solanum lycopersicum	MicroTom	flower, open	392	120.95
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	195	51.19
S0373	Solanum lycopersicum	Heinz 1706	fruit	482	144.27
S0372	Solanum lycopersicum	Heinz 1706	flower	244	73.84
S0371	Solanum lycopersicum	Heinz 1706	leaf	230	69.31