Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UGAAUCCUUCGGCUAUCCAUAA	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	124	12.08
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	82	10.87
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	633	73.95
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	99	21.32
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	16392	1209.07
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	628	262.61
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	160	163.61
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	2531	637.07
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	615	174.31
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	3667	938.17
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	1029	495.67
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	395	328.14
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	1308	741.64
S0708	Solanum lycopersicum	MicroTom	flower, open	8334	2571.41
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	1819	477.54
S0373	Solanum lycopersicum	Heinz 1706	fruit	2623	785.1
S0372	Solanum lycopersicum	Heinz 1706	flower	1737	525.69
S0371	Solanum lycopersicum	Heinz 1706	leaf	834	251.32