Tomato Functional Genomics Database (TFGD)

Tomato sRNA S23094735

Sequence	Length	annotation
UGACAGAAGAGAGUGAGCAC	20	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	34	3.31
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	30	3.98
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	5	0.58
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	3	0.65
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	12803	944.35
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	4236	3264.32
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	4286	3251.39
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	4226	3010.76
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	4185	3082.16
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	4407	2751.76
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	2314	1474.12
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	4186	2758.78
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	5937	3629.57
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	4218	2524.95
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	14810	14450.1
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	2691	1570.93
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	2918	2862.37
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	1618	1144.3
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	18737	20397.1
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	9935	9492.46
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	40417	116754
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	5453	3798.78
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	6514	8692.51
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	1622	678.26
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	216	220.87
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	5169	1301.06
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	174	49.32
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	1409	360.48
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	232	111.75
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	54	44.86
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	33	18.71
S0708	Solanum lycopersicum	MicroTom	flower, open	195	60.17
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	750	196.9
S0373	Solanum lycopersicum	Heinz 1706	fruit	601	179.89
S0372	Solanum lycopersicum	Heinz 1706	flower	3008	910.35
S0371	Solanum lycopersicum	Heinz 1706	leaf	8276	2493.9