Tomato sRNA S23094736
| Sequence | Length | annotation |
|---|
| UGACAGAAGAGAGUGAGCACA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 51 | 3.76 | | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 18 | 13.87 | | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 14 | 10.62 | | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 14 | 9.97 | | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 14 | 10.31 | | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 16 | 9.99 | | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 10 | 6.37 | | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 13 | 8.57 | | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 24 | 14.67 | | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 23 | 13.77 | | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 79 | 77.08 | | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 28 | 16.35 | | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 19 | 18.64 | | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 17 | 12.02 | | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 33 | 35.92 | | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 25 | 23.89 | | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 58 | 167.55 | | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 13 | 9.06 | | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 55 | 73.39 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 2 | 0.84 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 4 | 4.09 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 11 | 2.77 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 7 | 1.79 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 5 | 2.41 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 2 | 1.66 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 4 | 1.23 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 5 | 1.31 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 2 | 0.6 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 3 | 0.91 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 5 | 1.51 |
|
