Tomato sRNA S23094797
| Sequence | Length | annotation |
| UGACAGAAGAUAGAGAGCAC | 20 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 12 | 1.17 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 7 | 0.93 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 4 | 0.47 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 7 | 1.51 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3510 | 258.9 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 23 | 9.62 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 4 | 4.09 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 255 | 64.18 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 47 | 13.32 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 455 | 116.41 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 127 | 61.18 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 38 | 31.57 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 39 | 22.11 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 56 | 17.28 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 970 | 254.65 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 90 | 26.94 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 420 | 127.11 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1497 | 451.11 |
|