Tomato sRNA S23224349
Sequence | Length | annotation |
UGAGAUGGUAAUAACGGUGAU | 21 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 17 | 1.66 | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 88 | 11.66 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 161 | 18.81 | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 7993 | 589.56 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 900 | 376.35 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 89 | 91.01 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 1276 | 321.18 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 301 | 85.31 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 676 | 172.95 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 4 | 1.93 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 12 | 6.8 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 333 | 102.75 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 82 | 21.53 | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 4145 | 1240.66 | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 1053 | 318.68 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 12447 | 3750.8 |
|