Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
UGGAAGGGAGAAUAUCCAGGA	21	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	14381	1401.35
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	17846	2365.4
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	15829	1849.18
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	1636	352.3
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	54714	4035.7
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	797	333.28
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	67	68.51
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	590	148.51
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	176	49.88
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	246	62.94
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	71	34.2
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	57	47.35
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	80	45.36
S0708	Solanum lycopersicum	MicroTom	flower, open	107	33.01
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	190	49.88
S0373	Solanum lycopersicum	Heinz 1706	fruit	18627	5575.32
S0372	Solanum lycopersicum	Heinz 1706	flower	4350	1316.49
S0371	Solanum lycopersicum	Heinz 1706	leaf	15496	4669.59