Tomato sRNA S23592696
| Sequence | Length | annotation |
| UGGAAGGGAGAAUAUCCAGGA | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 14381 | 1401.35 | | S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 17846 | 2365.4 | | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 15829 | 1849.18 | | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1636 | 352.3 | | S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 54714 | 4035.7 | | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 797 | 333.28 | | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 67 | 68.51 | | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 590 | 148.51 | | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 176 | 49.88 | | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 246 | 62.94 | | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 71 | 34.2 | | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 57 | 47.35 | | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 80 | 45.36 | | S0708 | Solanum lycopersicum | MicroTom | flower, open | 107 | 33.01 | | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 190 | 49.88 | | S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 18627 | 5575.32 | | S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4350 | 1316.49 | | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 15496 | 4669.59 |
|