Tomato sRNA S23636860
Sequence | Length | annotation |
UGGACGGCGAGGACAUGAGUGAA | 23 | miRNA |
expression
Sample | No. raw reads | RPM |
ID | Organism | Cultivar | Tissue |
S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 | S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 | S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 | S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 134 | 103.26 | S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 98 | 74.34 | S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 134 | 95.47 | S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 150 | 110.47 | S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 123 | 76.8 | S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 121 | 77.08 | S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 159 | 104.79 | S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 159 | 97.2 | S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 224 | 134.09 | S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 17 | 16.59 | S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 40 | 23.35 | S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 31 | 30.41 | S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 31 | 21.92 | S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 49 | 53.34 | S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 36 | 34.4 | S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 12 | 34.66 | S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 159 | 110.77 | S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 101 | 134.78 | S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 9 | 3.76 | S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 | S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 15 | 3.78 | S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 46 | 13.04 | S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 38 | 9.72 | S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 38 | 18.3 | S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 24 | 19.94 | S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 28 | 15.88 | S0708 | Solanum lycopersicum | MicroTom | flower, open | 11 | 3.39 | S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 63 | 16.54 | S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 1 | 0.3 |
|